Help & Supportcareers@gravityer.com
AI is analyzing your overall score…
Identifying your key strengths…
Evaluating your skill match against the job requirements…
Assessing your cultural and operational fit
DNS-Zone-Disclosure
September 2, 2024 – September 2, 2024
DNS Zone Transfer Information Disclosure
View ProjectDNS-Record-Injection
September 2, 2024 – September 2, 2024
DNS Server Dynamic Update Record Injection
View ProjectRedacted-Request
August 29, 2023 – May 29, 2024
The "Redacted Request Extension" is a powerful tool designed to enhance the security and confidentiality of HTTP request handling within the Burp Suite.
View ProjectProject-Automation
October 3, 2019 – October 3, 2019
This Is a tool build in python for the automation of VAPT so feel free to contribute if any one wants to.
View ProjectDNA-Genetic-Python-Scripts-CTF
April 23, 2019 – March 30, 2023
a code written by me to decode the DNA Cipher (Genetic ) CTF challenge in which it is in the form of GAAACCACATATGATAAAACATAC
View ProjectCultural Fit Analysis
The candidate's projects are heavily focused on cybersecurity tools and scripting, primarily in Python. This indicates a strong interest in a specific niche within software engineering. The diversity of projects within this niche (phishing, DoS, DNS, SQLi) shows a broad exploration of security concepts. However, the lack of team-based projects or diverse technology stacks might suggest a preference for individual contributions or a narrower scope of work, which may or may not align with a collaborative software engineering role depending on the team's needs.
Soft Skills & Operational Fit
Insufficient data to assess soft skills or operational fit. No psychometric test results or interview feedback provided.